ID: 932577015_932577027

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 932577015 932577027
Species Human (GRCh38) Human (GRCh38)
Location 2:72968316-72968338 2:72968354-72968376
Sequence CCTTCCACCCTCTACACAAACTG CACCCCCTCATCTCTTGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 246} {0: 1, 1: 0, 2: 4, 3: 33, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!