ID: 932579262_932579265

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 932579262 932579265
Species Human (GRCh38) Human (GRCh38)
Location 2:72982998-72983020 2:72983023-72983045
Sequence CCCAGGACAAGCTGCCACAGGTG CACTGCTGCCTCCTGCTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 222} {0: 1, 1: 0, 2: 13, 3: 374, 4: 9874}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!