ID: 932591240_932591245

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 932591240 932591245
Species Human (GRCh38) Human (GRCh38)
Location 2:73069177-73069199 2:73069205-73069227
Sequence CCCTTGATCAGATCTGCACTGTT TCTGACTTGCAGAAAGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 141} {0: 1, 1: 0, 2: 3, 3: 29, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!