ID: 932618275_932618278

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 932618275 932618278
Species Human (GRCh38) Human (GRCh38)
Location 2:73249948-73249970 2:73249964-73249986
Sequence CCTGCCTGGGTCTGGTCTTCTGC CTTCTGCCATCTTTTGGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 308} {0: 1, 1: 0, 2: 1, 3: 29, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!