ID: 932621832_932621845

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 932621832 932621845
Species Human (GRCh38) Human (GRCh38)
Location 2:73269341-73269363 2:73269385-73269407
Sequence CCGGCCGCCTGCTCCTTGCCCTG CTCTCGCCGGGCGCCGGGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 587} {0: 1, 1: 0, 2: 0, 3: 11, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!