ID: 932626237_932626240

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 932626237 932626240
Species Human (GRCh38) Human (GRCh38)
Location 2:73298357-73298379 2:73298373-73298395
Sequence CCTGTCTTTCACTATTATAAAGG ATAAAGGATCTGGCTATATATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!