|
Left Crispr |
Right Crispr |
Crispr ID |
932658755 |
932658764 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:73633880-73633902
|
2:73633921-73633943
|
Sequence |
CCCTCCACCTTCCTGGTTCAAGT |
TCCCGAGTAGCTGGGACTACAGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 54379, 1: 173656, 2: 264604, 3: 194654, 4: 115454} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|