ID: 932658755_932658764

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 932658755 932658764
Species Human (GRCh38) Human (GRCh38)
Location 2:73633880-73633902 2:73633921-73633943
Sequence CCCTCCACCTTCCTGGTTCAAGT TCCCGAGTAGCTGGGACTACAGG
Strand - +
Off-target summary No data {0: 54379, 1: 173656, 2: 264604, 3: 194654, 4: 115454}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!