ID: 932658756_932658763

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 932658756 932658763
Species Human (GRCh38) Human (GRCh38)
Location 2:73633881-73633903 2:73633913-73633935
Sequence CCTCCACCTTCCTGGTTCAAGTG CCTCAGTCTCCCGAGTAGCTGGG
Strand - +
Off-target summary {0: 18, 1: 826, 2: 13834, 3: 49322, 4: 106393} {0: 3228, 1: 113305, 2: 296144, 3: 221452, 4: 120028}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!