ID: 932658757_932658763

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 932658757 932658763
Species Human (GRCh38) Human (GRCh38)
Location 2:73633884-73633906 2:73633913-73633935
Sequence CCACCTTCCTGGTTCAAGTGATT CCTCAGTCTCCCGAGTAGCTGGG
Strand - +
Off-target summary {0: 41, 1: 1775, 2: 28545, 3: 74922, 4: 101418} {0: 3228, 1: 113305, 2: 296144, 3: 221452, 4: 120028}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!