|
Left Crispr |
Right Crispr |
Crispr ID |
932658759 |
932658761 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:73633891-73633913
|
2:73633912-73633934
|
Sequence |
CCTGGTTCAAGTGATTCTCCTGC |
GCCTCAGTCTCCCGAGTAGCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 33779, 1: 81745, 2: 101616, 3: 124160, 4: 74442} |
{0: 2967, 1: 106420, 2: 268158, 3: 215749, 4: 131204} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|