ID: 932699826_932699843

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 932699826 932699843
Species Human (GRCh38) Human (GRCh38)
Location 2:73984991-73985013 2:73985044-73985066
Sequence CCTCGGCCCGGGCGGGGGGCTCC CGGGAGGCGGGAGCCCCAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 392} {0: 1, 1: 0, 2: 2, 3: 47, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!