ID: 932705401_932705405

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 932705401 932705405
Species Human (GRCh38) Human (GRCh38)
Location 2:74020688-74020710 2:74020703-74020725
Sequence CCACCTCTTGTTCAAGGGCTTGA GGGCTTGAGGGCTATGCCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 123} {0: 1, 1: 0, 2: 1, 3: 11, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!