ID: 932706222_932706227

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 932706222 932706227
Species Human (GRCh38) Human (GRCh38)
Location 2:74026939-74026961 2:74026953-74026975
Sequence CCACCACTCCTACTGTCCCCTGC GTCCCCTGCAGTGACGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 498} {0: 1, 1: 0, 2: 0, 3: 25, 4: 374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!