ID: 932713892_932713895

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 932713892 932713895
Species Human (GRCh38) Human (GRCh38)
Location 2:74087835-74087857 2:74087861-74087883
Sequence CCGCAGGCACACGCTGGAGGAGA TACTCTGCCTGGTGCGGCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 205} {0: 1, 1: 0, 2: 1, 3: 7, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!