ID: 932736889_932736902

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 932736889 932736902
Species Human (GRCh38) Human (GRCh38)
Location 2:74260589-74260611 2:74260620-74260642
Sequence CCCCTCCCTCCCATCCACCAGCC AGAAATCTAGGAGCAGCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 160, 4: 1567} {0: 1, 1: 0, 2: 1, 3: 16, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!