ID: 932736890_932736901

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 932736890 932736901
Species Human (GRCh38) Human (GRCh38)
Location 2:74260590-74260612 2:74260619-74260641
Sequence CCCTCCCTCCCATCCACCAGCCC CAGAAATCTAGGAGCAGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 245, 4: 2374} {0: 1, 1: 1, 2: 3, 3: 98, 4: 1399}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!