ID: 932736897_932736901

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 932736897 932736901
Species Human (GRCh38) Human (GRCh38)
Location 2:74260606-74260628 2:74260619-74260641
Sequence CCAGCCCTTTAGACAGAAATCTA CAGAAATCTAGGAGCAGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 137} {0: 1, 1: 1, 2: 3, 3: 98, 4: 1399}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!