ID: 932737459_932737461

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 932737459 932737461
Species Human (GRCh38) Human (GRCh38)
Location 2:74264269-74264291 2:74264285-74264307
Sequence CCATCCTCAATCTGCTTCTCAAT TCTCAATGACATCATCTGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 311} {0: 1, 1: 0, 2: 2, 3: 15, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!