ID: 932747321_932747328

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 932747321 932747328
Species Human (GRCh38) Human (GRCh38)
Location 2:74344690-74344712 2:74344715-74344737
Sequence CCTAGGCCAGAAACAGTTTCGGG TTAGGGAATTTCCAGCTGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 97} {0: 1, 1: 0, 2: 2, 3: 7, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!