ID: 932749092_932749095

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 932749092 932749095
Species Human (GRCh38) Human (GRCh38)
Location 2:74359907-74359929 2:74359922-74359944
Sequence CCCATTCTCCTTTCAAAGTGCCA AAGTGCCACCAGAAGTTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 420} {0: 1, 1: 0, 2: 2, 3: 11, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!