ID: 932753167_932753173

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 932753167 932753173
Species Human (GRCh38) Human (GRCh38)
Location 2:74385412-74385434 2:74385436-74385458
Sequence CCCTGAATCAACCAGCAAGTTCC GGCACTAGGACCCTGTAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 119} {0: 1, 1: 0, 2: 0, 3: 4, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!