ID: 932766320_932766325

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 932766320 932766325
Species Human (GRCh38) Human (GRCh38)
Location 2:74472749-74472771 2:74472770-74472792
Sequence CCGGCCGCCGGCTGCTTAGCAGG GGCCTGCGAACCGCAGCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 124} {0: 1, 1: 0, 2: 0, 3: 8, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!