ID: 932776342_932776355

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 932776342 932776355
Species Human (GRCh38) Human (GRCh38)
Location 2:74530267-74530289 2:74530312-74530334
Sequence CCCAGATACCAGGACCCGGGAGG TTCGCGCGCGTGGCTGGCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 125} {0: 1, 1: 0, 2: 0, 3: 9, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!