ID: 932776344_932776348

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 932776344 932776348
Species Human (GRCh38) Human (GRCh38)
Location 2:74530268-74530290 2:74530283-74530305
Sequence CCAGATACCAGGACCCGGGAGGC CGGGAGGCCTCAGAGAACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 128} {0: 1, 1: 0, 2: 1, 3: 42, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!