ID: 932776346_932776360

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 932776346 932776360
Species Human (GRCh38) Human (GRCh38)
Location 2:74530281-74530303 2:74530327-74530349
Sequence CCCGGGAGGCCTCAGAGAACTCT GGCGGTGGCGCTGGGCGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 105, 4: 500} {0: 1, 1: 0, 2: 5, 3: 73, 4: 763}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!