ID: 932776347_932776350

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 932776347 932776350
Species Human (GRCh38) Human (GRCh38)
Location 2:74530282-74530304 2:74530302-74530324
Sequence CCGGGAGGCCTCAGAGAACTCTG CTGGAACCCGTTCGCGCGCGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 280} {0: 1, 1: 0, 2: 0, 3: 0, 4: 16}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!