ID: 932776347_932776351

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 932776347 932776351
Species Human (GRCh38) Human (GRCh38)
Location 2:74530282-74530304 2:74530306-74530328
Sequence CCGGGAGGCCTCAGAGAACTCTG AACCCGTTCGCGCGCGTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 280} {0: 1, 1: 0, 2: 0, 3: 0, 4: 9}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!