ID: 932776349_932776357

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 932776349 932776357
Species Human (GRCh38) Human (GRCh38)
Location 2:74530290-74530312 2:74530319-74530341
Sequence CCTCAGAGAACTCTGGAACCCGT GCGTGGCTGGCGGTGGCGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 148} {0: 1, 1: 0, 2: 0, 3: 14, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!