ID: 932780455_932780460

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 932780455 932780460
Species Human (GRCh38) Human (GRCh38)
Location 2:74555676-74555698 2:74555690-74555712
Sequence CCTCAGAAGCCCGGGCAGGGATG GCAGGGATGGAGTGAAGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 242} {0: 1, 1: 0, 2: 7, 3: 84, 4: 1084}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!