ID: 932793464_932793468

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 932793464 932793468
Species Human (GRCh38) Human (GRCh38)
Location 2:74675185-74675207 2:74675217-74675239
Sequence CCGGCACTTTGGCTCATCTCTCT ACCGCGTACTCACCTTCATCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 298} {0: 1, 1: 0, 2: 0, 3: 2, 4: 23}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!