ID: 932813281_932813283

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 932813281 932813283
Species Human (GRCh38) Human (GRCh38)
Location 2:74841991-74842013 2:74842017-74842039
Sequence CCCTGGGGTTGAACTCTGGCTTT CATAACACGCAGTGTGAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 237} {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!