ID: 932813281_932813285

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 932813281 932813285
Species Human (GRCh38) Human (GRCh38)
Location 2:74841991-74842013 2:74842040-74842062
Sequence CCCTGGGGTTGAACTCTGGCTTT GTCAGTTACTCTACCTGTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 237} {0: 1, 1: 0, 2: 1, 3: 33, 4: 518}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!