ID: 932818205_932818216

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 932818205 932818216
Species Human (GRCh38) Human (GRCh38)
Location 2:74878524-74878546 2:74878564-74878586
Sequence CCTCCTCCTGCCCCTGCACAGGT GGGATTCTGTCCCCACTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 92, 4: 749} {0: 1, 1: 0, 2: 0, 3: 18, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!