ID: 932837308_932837319

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 932837308 932837319
Species Human (GRCh38) Human (GRCh38)
Location 2:75049636-75049658 2:75049678-75049700
Sequence CCGGGTGGATTTCATTTCCAGCC GATGAAGGGGCAGCACCGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 203} {0: 1, 1: 0, 2: 1, 3: 12, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!