ID: 932839830_932839832

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 932839830 932839832
Species Human (GRCh38) Human (GRCh38)
Location 2:75071856-75071878 2:75071870-75071892
Sequence CCAAACTGGAAGAGAGAACTGAG AGAACTGAGAACAAACCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 240} {0: 1, 1: 0, 2: 2, 3: 34, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!