ID: 932842413_932842417

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 932842413 932842417
Species Human (GRCh38) Human (GRCh38)
Location 2:75095814-75095836 2:75095828-75095850
Sequence CCCTGTCCCTTCTGTGTGCCCTT TGTGCCCTTCTAGATGCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 67, 4: 505} {0: 1, 1: 0, 2: 0, 3: 27, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!