ID: 932889322_932889326

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 932889322 932889326
Species Human (GRCh38) Human (GRCh38)
Location 2:75578514-75578536 2:75578550-75578572
Sequence CCTTGGTCCTTCTGTCATGTGAG CTAGAAAATGGACCTTCACCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!