ID: 932895477_932895486

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 932895477 932895486
Species Human (GRCh38) Human (GRCh38)
Location 2:75635485-75635507 2:75635512-75635534
Sequence CCCTCAGCCCTCTTTACCCAGGA TCTCAGGTGTGGGTTTGCTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!