ID: 932993121_932993141

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 932993121 932993141
Species Human (GRCh38) Human (GRCh38)
Location 2:76812770-76812792 2:76812809-76812831
Sequence CCCTCCCCCTCCTCCTCTCCCTC TTATTCTTCCTCTTGCATTAAGG
Strand - +
Off-target summary {0: 10, 1: 180, 2: 877, 3: 4908, 4: 11900} {0: 1, 1: 0, 2: 3, 3: 26, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!