ID: 932993131_932993141

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 932993131 932993141
Species Human (GRCh38) Human (GRCh38)
Location 2:76812792-76812814 2:76812809-76812831
Sequence CCCCCCCCTCCTCCTCCTTATTC TTATTCTTCCTCTTGCATTAAGG
Strand - +
Off-target summary {0: 1, 1: 16, 2: 456, 3: 2210, 4: 9381} {0: 1, 1: 0, 2: 3, 3: 26, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!