ID: 932998875_932998879

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 932998875 932998879
Species Human (GRCh38) Human (GRCh38)
Location 2:76895760-76895782 2:76895798-76895820
Sequence CCAATTCTGTTTTTTATAAAAAA ACTTCCATGCAGTCTGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 203, 4: 1956} {0: 1, 1: 0, 2: 0, 3: 15, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!