ID: 933029712_933029718

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 933029712 933029718
Species Human (GRCh38) Human (GRCh38)
Location 2:77313169-77313191 2:77313203-77313225
Sequence CCTCCCTATTTTTTCCTGAGACC TGTGCCTCCCGATGTTTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 301} {0: 1, 1: 1, 2: 3, 3: 7, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!