ID: 933171613_933171621

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 933171613 933171621
Species Human (GRCh38) Human (GRCh38)
Location 2:79131738-79131760 2:79131789-79131811
Sequence CCAATCGTGGTCCTTGTATCATT GGAGAAGAGTGCACAATGCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 19, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!