ID: 933178833_933178842

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 933178833 933178842
Species Human (GRCh38) Human (GRCh38)
Location 2:79207310-79207332 2:79207358-79207380
Sequence CCGGTTTCACCTAGGTAGTCCAG AAAGCTACCCCTTAAGGTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 100} {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!