ID: 933185558_933185560

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 933185558 933185560
Species Human (GRCh38) Human (GRCh38)
Location 2:79275232-79275254 2:79275256-79275278
Sequence CCAAAAGAGGTAACTGGAGTTTA ATCTTGTCCAAGAGGATCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 159} {0: 1, 1: 0, 2: 2, 3: 12, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!