ID: 933194336_933194349

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 933194336 933194349
Species Human (GRCh38) Human (GRCh38)
Location 2:79371577-79371599 2:79371626-79371648
Sequence CCCAAGAAAATGAGTTGGCCTGA CCTACTTTGCAGGAGGAACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 176} {0: 1, 1: 0, 2: 2, 3: 24, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!