ID: 933215831_933215836

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 933215831 933215836
Species Human (GRCh38) Human (GRCh38)
Location 2:79629093-79629115 2:79629109-79629131
Sequence CCCTTCCCCTTATTGCTTCCCCT TTCCCCTATGCCAGCCATATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 79, 4: 598} {0: 1, 1: 0, 2: 2, 3: 7, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!