ID: 933249070_933249078

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 933249070 933249078
Species Human (GRCh38) Human (GRCh38)
Location 2:80008286-80008308 2:80008302-80008324
Sequence CCCGCAGTCACCCCACTGTGCTC TGTGCTCTTAAGGAGGATTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 258} {0: 1, 1: 0, 2: 0, 3: 20, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!