ID: 933254338_933254342

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 933254338 933254342
Species Human (GRCh38) Human (GRCh38)
Location 2:80063541-80063563 2:80063574-80063596
Sequence CCCTTCACGTAACTGTCTACAGT CCTGATTAACAGTATTTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 78} {0: 1, 1: 0, 2: 1, 3: 6, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!