ID: 933258693_933258695

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 933258693 933258695
Species Human (GRCh38) Human (GRCh38)
Location 2:80108193-80108215 2:80108206-80108228
Sequence CCAGAGGGGAGCAGCCTTGGGTA GCCTTGGGTAGCCTAGGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 139} {0: 1, 1: 0, 2: 2, 3: 6, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!